Base styles

Defining and applying custom base styles: The Base styles example
Java Get Powered

A first solution for drawing custom-styled bases is the following:

  • First, declare a numbered style by adding a parameter of the sort:
        name="basesStyleX" value="label=Yl,fill=Yf,outline=Yo,number=Yn"
    where 1<X<50, and Yl, Yf, Yo, and Yn are valid HTML colors (e.g. #550055) for label (nucleotides), filling (background), outline and base number respectively.

  • Then, apply the numbered style to a set of bases (or contiguous portions of bases) through:     name="applyBasesStyleXon" value="1,3,6-10"
    In the example above, the style X will be used to draw bases 1, 3, 6, 7, 8, 9, and 10.

Remarks: None of the colors is mandatory, as described in the parameter description. Also, the number of styles is limited to 50, since it is impossible to get a complete list of parameters from within an applet. Consequently, VARNA has to check for the presence of any basesStyleX and applybasesStyleXon parameters and had to stop somewhere...

Alternatively, one can specify custom styles directly for a small list of bases using the customBases parameter, using a very similar syntax but avoiding the declaration of a dummy style when a few bases are concerned (Zoom in on bases 30 and 31 above).

Finally, if the colors are associated to some quantifiable semantics (Conservation, Boltzmann probability...), one can associate values with individual bases and let the color be automatically chosen according to a color map (Example here).

<applet  code="VARNA.class" codebase="bin" archive="VARNA.jar" 
    width="500" height="350">
  <param name="sequenceDBN"  value="GGCACUCUUCCGUGGUCUGGUGGAUAAAUUCGCAAGGGUAUCAUG
      GCGUGGACGACCGGGGUUCGAACCCCGGAUCCGUGAUCCAUGCGGUUACCGUCCGCCGCCCGUGCGUCGAACCCA
      GGUGUGCGACGUCAGACAACGGGGGAGCGCUCCUU" />
  <param name="structureDBN" value="((((((((((((((..((((((.............((((..((((
      ((((((.....((.((((........).))).).)))))..))))))...((((.......)))).....)))).
      .........)))))).).)))))))))))).)..." />
  <param name="title" value="Human integrated adenovirus 2 VA-RNA (RFAM:RF00102)"/>
  <param name="titleSize" value="18" />
  <param name="applyBasesStyle1on" value="57-58,60-63,72,74-76,78,80"/>
  <param name="applyBasesStyle2on" value="17-22,130-135" />
  <param name="applyBasesStyle3on" value="15,16,23-35,40,41,52-56,59,64-71,73,77,
      79,85,86,93-95,100-106,111-115,120-129,136,138,151" />
  <param name="applyBasesStyle4on" value="36-39,116-119" />
  <param name="applyBasesStyle5on" value="96-99,107-110" />
  <param name="applyBasesStyle6on" value="42-51,81-84,87-92" />
  <param name="applyBasesStyle7on" value="1-14,137-155" />
  <param name="basesStyle1" value="label=#ff0000,fill=#ffcccc,outline=#ff4d4d" />
  <param name="basesStyle2" value="label=#0000e5,fill=#ccccff,outline=#4d4dff" />
  <param name="basesStyle3" value="label=#00cc00,fill=#ccffcc,outline=#00f200" />
  <param name="basesStyle4" value="label=#cc6600,fill=#ffe5cc,outline=#f27900" />
  <param name="basesStyle5" value="label=#bf0040,fill=#f2ccd9,outline=#c20d49" />
  <param name="basesStyle6" value="label=#009ccb,fill=#c7eafb,outline=#009ccb" />
  <param name="basesStyle7" value="label=#d7ca44,fill=#fffac2,outline=#ecdc2a" />
  <param name="customBases" value="29:fill=#FFFFFF,label=#0000FF,outline=#FF0000;
      30:fill=#FFFFFF,label=#FF0000;" />
</applet>

Previous page: Specifications
Next page: Downloads